keywords:
Bookmark and Share



Front Back
What is the spliceosome?
The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes. Following the GU-AG rule, introns are excised and removed from mRNA and the exons are joined to form a mature mRNA molecule ready for translation. The spliceosome is made of five small nuclear ribonucleoproteins (snRNPs) which consists of proteins and one of five snRNAs (U1, U2, U4, U5 and U6) which together with over 100 proteins form the large biological machine used for splicing.
What are the three classes of “functional” RNAs?  Briefly describe the role of each class of functional RNA
tRNA (brings the correct amino acid to the mRNA during translation); rRNA (major component of ribosomes); snRNA [helps process RNA transcripts (especially, helps remove introns)].
DNA ligase:
phosphodiester bonds at DNA nicks
An organism has an A + T content of 47%. What is the percentage for C?
26.5
The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule. a. transcription b. intron removal c. stability d. initiation of translation
a. transcription
Uracil contains ____ as sugar.
ribose
Codon that specify the same amino acid are said to be ______.
synonymous.
This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them:  
DNA ligase
Which of the sequences could form a hairpin? TTCAATAATCGCTAATAACTGA TTACGGCGGTTCCGCCGGTG ATTATTTCGTACCCCCAATTTT ATTAGGCCCTACCGCCAATTTT CGCCAAAAAATCGCCCCCCAATTA GCCGCCGCCGCCCCATTATTATTAT ATTATTTCGTACCCCCAATTTT GCCGCCGCCGCCCCATTATTATTAT TTCAATAATCGCTAATAACTGA CGCCAAAAAATCGCCCCCCAATTA ATTATTGGCGCTAACGCCAATTTT 
TTACGGCGGTTCCGCCGGTG  ATTATTGGCGCTAACGCCAATTTT
Which is not true of amino acids? a)There are 20 of them required in the body b) They are the building blocks of proteins c) tRNA brings them to the ribosome for protein synthesis d) all of the above are true
d) all of the above are true
The role of tRNA is: to serve as an intermediate in the decoding of genes. to act as transporters bringing amino acids to the site of protein synthesis. to serve as general translational components of the ribosome. to facilitate splicing of pre-messenger RNAs. to facilitate splicing of pre-messenger RNAs.
to act as transporters bringing amino acids to the site of protein synthesis.
Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes: excision of introns fusion into circular forms known as plasmids linkage to histone molecules union with ribosomes
excision of introns
What is the function of the TATA binding protein? Aids in the removal of introns from eukaryotic pre-mRNA Allows prokaryotic RNA polymerase to bind to the promoter of genes Allows eukaryotic RNA polymerase II to bind to the promoter of genes Helps termination factors bind and terminate transcription.
Allows eukaryotic RNA polymerase II to bind to the promoter of genes
The anticodon on the tRNA molecule: binds to the mRNA in a complementary fashion. is oriented and written in the 5’→ 3’ direction. is a catalytic part of protein synthesis. is the same for all tRNA molecules. contains amino-acyl-tRNA synthtase.
binds to the mRNA in a complementary fashion.
All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one? tRNA mRNA Methionine Initiation factors
mRNA
What is the function of peptidyl transferase activity?             It charges tRNAs.             It acetylates the end of a protein after translation.         It cleaves the polypeptide from the last tRNA during termination.             It moves ribosomes along mRNA during translation.            It forms peptide bonds.
It forms peptide bonds.
A+G=T+C __ A+C=G+T A+T/A+G = 1.0 A+G/C+T = 1.0 A/C = G/T A/G = T/C_ A/T = G/C A+T=G+C
yes no yes no yes yes no
After the peptide bond forms, what will happen? tRNA A will be carrying the polypeptide and it will shift to the P site. tRNA A will be carrying the polypeptide and it will shift to the A site. tRNA B will be carrying the polypeptide and it will shift to the P site. tRNA B will be carrying the polypeptide and it will shift to the A site.
tRNA B will be carrying the polypeptide and it will shift to the P site.
In biology, most information flows through which sequence? a)        protein to DNA to RNA b)        protein to RNA to DNA c)         RNA to DNA to protein d)        DNA to RNA to protein
d)        DNA to RNA to protein
If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?
30%
How do centromeres help control the cell cycle?             by inhibiting the S phase until the cell is ready to double its DNA content             by inhibiting anaphase until spindle fibers are attached to chromosomes             by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes             by activating cell cycle control genes
by inhibiting anaphase until spindle fibers are attached to chromosomes
A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase.  He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive.  You think that this is a foolish idea that will not work.  Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.
Prokaryotic and eukaryotic RNA polymerases are different.  The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.
What are the four nucleotides that make up RNA?
Adenine (A), guanine (G), cytosine (C), and uracil (U)
When _____ is synthesized, both strands of a DNA molecule are used as a template.
DNA
Continuous synthesis:  
leading strand.
The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___. a. mRNA stability                                                                                                                b. translation c. intron splicing                                                                                                       d. protein stability
b. translation c. intron splicing
Which is true of the secondary structure of DNA?             Sugar-phosphate groups are on the inside of the DNA molecule.             Cytosine pairs with adenine.             Bases on complementary strands are held together by hydrogen bonds.             Nucleotide bases are on the outside of the DNA molecule.             Thymine pairs with guanine
Bases on complementary strands are held together by hydrogen bonds.
Which of these sequences, if paired with its complementary strand, would be a palindrome?             5' CCCCCC 3'             5' CCCGGG 3'             5' CTGCTG 3'             5' TCCCCT 3'
5' CCCGGG 3'
Transcription of the sequence AATGCGGTC would result in:             TTACGCCAG              Three amino acids              UUACGCCAG              Not enough information to tell
UUACGCCAG
Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?  Methionine
Methionine
An organism has a G content of 19%.  What is the percentage for A?
31%
Okazaki fragments:
lagging strand
This Greek letter describes the shape of a bacterial chromosome mid-way through replication:
Theta
In transcription, nucleotides are always added to the ____ end of the elongating strand.
3’
In eukaryotes, tRNAs are             transcribed in the nucleus, and function in the nucleus.             transcribed in the nucleus, but function in the cytoplasm.             transcribed in the cytoplasm, and function in the cytoplasm.             transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm.
transcribed in the nucleus, but function in the cytoplasm.transcribed in the nucleus, but function in the cytoplasm.
Hairpins are formed in DNA as a result of             a)        sequences on the opposite strand that are identical             b)        sequences on the opposite strand that are complementary             c)        sequences on the same strand that are inverted and complementary             d)        sequences on the same strand that are identical
c)        sequences on the same strand that are inverted and complementary
The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells.             a)        less, permanently             b)        more, permanently             c)         more, temporarily                            d)        less, temporarily
d)        less, temporarily
The ribosome is the primary site of:             oxidative phosphorylation.             protein packaging.             protein synthesis.             cellular respiration.             amino acid storage.
protein synthesis.
Which one of the following statements regarding eukaryotic transcriptions is not true?             Eukaryotic transcription involves a core promoter and a regulatory promoter.             There is no one generic promoter.             A group of genes is transcribed into a polycistronic RNA.             Chromatin remodeling is necessary before certain genes are transcribed.
A group of genes is transcribed into a polycistronic RNA.
A segment of DNA from Drosophila melanogaster has the sequence:
 5’ TCA AGC TTA AGA AGG CAT TTT 3’
                               (i) Assuming that this is the template strand, what is the sequence of the encoded mRNA (make sure to denote 5’ and 3’ ends of the transcript)? (ii) If this sequence is the coding strand, what is the sequence of the encoded mRNA?
(i) 3’ AGU UCG AAU UCU UCC GUA AAA 5’      -or- 5’ AAA AUG CCU UCU UAA GCU UGA 3’   (ii) 5’ UCA AGC UUA AGA AGG CAU UUU 3’
A friend gave you the following molecule and told you that it was a fragment of his RNA.  Do you believe him?  Justify your answer.                                                    5’ TCC TGA CGA TGC TAC CGA 3’
No, the molecule has T’s.  If it were truly RNA, it would have U’s rather than T’s
The concept that genetic information passes from DNA to RNA to protein is called ________
central dogma
The bonds that connect nucleotides in a strand are called _______ bonds.
phosphodiester
Which statement is true regarding negative supercoiled DNA? a)        That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.             b)        All of the above statements are true.             c)         Negative supercoiled DNA is not usually seen in cells.             d)        Negative supercoiled DNA has 10 base pairs per turn of its helix             e)        Negative supercoiled DNA carries more negative charges than positive supercoiled DNA         does.
a)        That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.
When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.             5' base             middle base             3' base
3' base
The “RNA World” theory suggests that:             RNA is the intermediate between DNA and proteins.             RNA was the genetic material in the first living cells.             many RNAs are capable of self-splicing.             eventually RNA will become the genetic material of most living organisms.             RNA viruses are more dangerous than DNA viruses.
RNA was the genetic material in the first living cells.
How many nucleotides would be expected for a gene coding for a protein with 300 amino acids?             300             100             600             1200             900
900
What is the function of eukaryotic RNA polymerase I?             transcription of rRNA genes             transcription of mRNA genes             transcription of tRNA genes             transcription of snRNAs             initiation of transcription (but not elongation)
transcription of rRNA genes
The nitrogenous base that is found in RNA but not in DNA is             a)        adenine             b)        uracil             c)         guanine             d)        cytosine             e)        None of the above
b)        uracil
Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm.  In addition, tell why each of the modifications is necessary.
Add 5’ cap (protect against degradation, acts as a binding site for the ribosome); add poly-A tail (possibly protect against degradation, possibly helps in the transfer of the mRNA to the cytoplasm); remove introns (forms a message that can be translated into a functional protein).
x of y cards Next > >|